Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Pullorum str. S06004
Start position: 2139751
End position: 2139780
Length: 30

DNA sequence
>NC_021984, from 2139751 to 2139780 (30 bp); Salmonella enterica subsp. enterica serovar Pullorum str. S06004 TTCGCGCCAGTTCGCGGCATCGCGCGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2139104-2140093	Sequence	I137_09885 moaA molybdenum cofactor biosynthesis protein A (Protein is coded in complementary strand; from 2140093 to 2139104)