Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Pullorum str. S06004
Start position: 2652879
End position: 2652923
Length: 45

DNA sequence
>NC_021984, from 2652879 to 2652923 (45 bp); Salmonella enterica subsp. enterica serovar Pullorum str. S06004 ACCTGCGCGGTGCCGACCTGCGCGATGCCGACCTGTGCGGTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2652777-2653091	Sequence	I137_12295 - hypothetical protein (Protein is coded in complementary strand; from 2653091 to 2652777)