Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Pullorum str. S06004
Start position: 3124990
End position: 3125013
Length: 24

DNA sequence
>NC_021984, from 3124990 to 3125013 (24 bp); Salmonella enterica subsp. enterica serovar Pullorum str. S06004 CCGGCGCTGGCGCCGGTGCTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3124670-3125563	Sequence	I137_14635 - chromosome replication initiation inhibitor protein