Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Pullorum str. S06004
Start position: 3868945
End position: 3868971
Length: 27

DNA sequence
>NC_021984, from 3868945 to 3868971 (27 bp); Salmonella enterica subsp. enterica serovar Pullorum str. S06004 GCGCCCGGCGCGCCAGGCGCGCACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3868199-3869581	Sequence	I137_18175 - 6-phospho-beta-glucosidase (Protein is coded in complementary strand; from 3869581 to 3868199)