Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Pullorum str. S06004
Start position: 3963499
End position: 3963522
Length: 24

DNA sequence
>NC_021984, from 3963499 to 3963522 (24 bp); Salmonella enterica subsp. enterica serovar Pullorum str. S06004 TTTCTTGTTCTTTTTGTTGTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3962943-3963626	Sequence	I137_18590 - membrane protein (Protein is coded in complementary strand; from 3963626 to 3962943)