Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Pullorum str. S06004
Start position: 4434303
End position: 4434338
Length: 36

DNA sequence
>NC_021984, from 4434303 to 4434338 (36 bp); Salmonella enterica subsp. enterica serovar Pullorum str. S06004 GGTGGCATGGGTGGTATGGGTGGTATGGGCGGCATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4432699-4434345	Sequence	I137_20680 groEL molecular chaperone GroEL