Sequence retrieval

Genome: Salmonella enterica subsp. enterica serovar Pullorum str. S06004
Start position: 999042
End position: 999071
Length: 30

DNA sequence
>NC_021984, from 999042 to 999071 (30 bp); Salmonella enterica subsp. enterica serovar Pullorum str. S06004 ACGAAAAATAACCAGAAATAACAAAAAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 998102-999256	Sequence	I137_04340 opgC glucan biosynthesis protein (Protein is coded in complementary strand; from 999256 to 998102)