Sequence retrieval

Genome: Borrelia burgdorferi CA382
Start position: 142864
End position: 142887
Length: 24

DNA sequence
>NC_022048, from 142864 to 142887 (24 bp); Borrelia burgdorferi CA382 ACTAAAACTAAGAATAAAACTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 141979-142932	Sequence	L144_00705 - membrane fusion protein (Protein is coded in complementary strand; from 142932 to 141979)