Sequence retrieval

Genome: Borrelia burgdorferi CA382
Start position: 170725
End position: 170748
Length: 24

DNA sequence
>NC_022048, from 170725 to 170748 (24 bp); Borrelia burgdorferi CA382 TCTTTTGTTCTTTTTTTCTTTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 170723-171100	Sequence	L144_00825 - DnaK suppressor, putative (Protein is coded in complementary strand; from 171100 to 170723)