Sequence retrieval

Genome: Borrelia burgdorferi CA382
Start position: 286051
End position: 286074
Length: 24

DNA sequence
>NC_022048, from 286051 to 286074 (24 bp); Borrelia burgdorferi CA382 CATTAACCTTAACATTAGCATAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 285972-287090	Sequence	L144_01340 flhB flagellar biosynthesis protein FlhB (Protein is coded in complementary strand; from 287090 to 285972)