Sequence retrieval

Genome: Borrelia burgdorferi CA382
Start position: 330711
End position: 330740
Length: 30

DNA sequence
>NC_022048, from 330711 to 330740 (30 bp); Borrelia burgdorferi CA382 AAACAAATAAAAACTAATAAAAAGAAATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 329647-330756	Sequence	L144_01595 - hypothetical protein (Protein is coded in complementary strand; from 330756 to 329647)