Sequence retrieval

Genome: Borrelia burgdorferi CA382
Start position: 741608
End position: 741632
Length: 25

DNA sequence
>NC_022048, from 741608 to 741632 (25 bp); Borrelia burgdorferi CA382 TTTTTTTCTTTTTATGTTTTTTATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 741405-742637	Sequence	L144_03470 - polynucleotide adenylyltransferase (Protein is coded in complementary strand; from 742637 to 741405)