Sequence retrieval

Genome: Borrelia burgdorferi CA382
Start position: 769550
End position: 769582
Length: 33

DNA sequence
>NC_022048, from 769550 to 769582 (33 bp); Borrelia burgdorferi CA382 TTGTTTTAAAATTTTTTTAGAATTTTTTTAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 769445-769570	Sequence	L144_03590 - hypothetical protein
ORF... 769556-771148	Sequence	L144_03595 pgi glucose-6-phosphate isomerase (Protein is coded in complementary strand; from 771148 to 769556)