Sequence retrieval

Genome: Bacillus amyloliquefaciens subsp. plantarum UCMB5033
Start position: 1271097
End position: 1271120
Length: 24

DNA sequence
>NC_022075, from 1271097 to 1271120 (24 bp); Bacillus amyloliquefaciens subsp. plantarum UCMB5033 TTATCTTTTTTTCTTTTTATCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1270503-1271120	Sequence	RBAU_1246 ykaA putative Pit accessory protein (Protein is coded in complementary strand; from 1271120 to 1270503)