Sequence retrieval

Genome: Bacillus amyloliquefaciens subsp. plantarum UCMB5033
Start position: 1346839
End position: 1346862
Length: 24

DNA sequence
>NC_022075, from 1346839 to 1346862 (24 bp); Bacillus amyloliquefaciens subsp. plantarum UCMB5033 TTCTTTATCTTTTTCCTTGTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1346330-1347157	Sequence	RBAU_1323 motB motility protein B; MotB component of the stator flagellum complex (Protein is coded in complementary strand; from 1347157 to 1346330)