Sequence retrieval

Genome: Bacillus amyloliquefaciens subsp. plantarum UCMB5033
Start position: 2167642
End position: 2167665
Length: 24

DNA sequence
>NC_022075, from 2167642 to 2167665 (24 bp); Bacillus amyloliquefaciens subsp. plantarum UCMB5033 TCATTTTCATTCTCCTTTTCATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2167287-2167646	Sequence	RBAU_2022 - hypothetical protein (Protein is coded in complementary strand; from 2167646 to 2167287)