Sequence retrieval

Genome: Bacillus amyloliquefaciens subsp. plantarum UCMB5033
Start position: 2194739
End position: 2194762
Length: 24

DNA sequence
>NC_022075, from 2194739 to 2194762 (24 bp); Bacillus amyloliquefaciens subsp. plantarum UCMB5033 TTTTTAATTTTATTTTTATTCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2194761-2194952	Sequence	RBAU_2058 yoqX putative SPbeta phage protein (Protein is coded in complementary strand; from 2194952 to 2194761)