Sequence retrieval

Genome: Bacillus amyloliquefaciens subsp. plantarum UCMB5033
Start position: 237048
End position: 237071
Length: 24

DNA sequence
>NC_022075, from 237048 to 237071 (24 bp); Bacillus amyloliquefaciens subsp. plantarum UCMB5033 GAAAATGTGAAAACGTGAAAATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 232326-238694	Sequence	RBAU_0205 - Tyrocidine synthase 3