Sequence retrieval

Genome: Bacillus amyloliquefaciens subsp. plantarum UCMB5033
Start position: 2423279
End position: 2423302
Length: 24

DNA sequence
>NC_022075, from 2423279 to 2423302 (24 bp); Bacillus amyloliquefaciens subsp. plantarum UCMB5033 TGTTTTTCTTTTTCTTTTCGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2423222-2423449	Sequence	RBAU_2314 yqkE hypothetical protein (Protein is coded in complementary strand; from 2423449 to 2423222)