Sequence retrieval

Genome: Bacillus amyloliquefaciens subsp. plantarum UCMB5033
Start position: 950024
End position: 950047
Length: 24

DNA sequence
>NC_022075, from 950024 to 950047 (24 bp); Bacillus amyloliquefaciens subsp. plantarum UCMB5033 GCTGCTGCTGATTCTGCTGCTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 949387-950052	Sequence	RBAU_0907 yhcQ Spore coat protein F-like protein yhcQ (Protein is coded in complementary strand; from 950052 to 949387)