Sequence retrieval

Genome: Bacillus amyloliquefaciens subsp. plantarum UCMB5033
Start position: 1863367
End position: 1863393
Length: 27

DNA sequence
>NC_022075, from 1863367 to 1863393 (27 bp); Bacillus amyloliquefaciens subsp. plantarum UCMB5033 GCATTTTTTACATTTTTTGCATTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1863362-1863517	Sequence	RBAU_1734 - hypothetical protein (Protein is coded in complementary strand; from 1863517 to 1863362)