Sequence retrieval

Genome: Bacillus amyloliquefaciens subsp. plantarum UCMB5033
Start position: 2933960
End position: 2933986
Length: 27

DNA sequence
>NC_022075, from 2933960 to 2933986 (27 bp); Bacillus amyloliquefaciens subsp. plantarum UCMB5033 GTTTCGCCTGTTTCGCATATTTCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2933465-2935051	Sequence	RBAU_2788 ytcI putative acyl-coenzyme A synthetase (Protein is coded in complementary strand; from 2935051 to 2933465)