Sequence retrieval

Genome: Bacillus amyloliquefaciens subsp. plantarum UCMB5033
Start position: 1182496
End position: 1182531
Length: 36

DNA sequence
>NC_022075, from 1182496 to 1182531 (36 bp); Bacillus amyloliquefaciens subsp. plantarum UCMB5033 CGGCGGCTACGGCGGTTACGGCGGCTGCGGCGGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1182471-1182632	Sequence	RBAU_1144 yjcZ putative type I toxin