Sequence retrieval

Genome: Bacillus amyloliquefaciens subsp. plantarum UCMB5033
Start position: 1820772
End position: 1820816
Length: 45

DNA sequence
>NC_022075, from 1820772 to 1820816 (45 bp); Bacillus amyloliquefaciens subsp. plantarum UCMB5033 GCCAAACCAAGGGCGGCCAAACCAAGGCCGGCCAAACCAAGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1820638-1820958	Sequence	RBAU_1694 ymaG inner spore coat protein; cell wall associated protein (Protein is coded in complementary strand; from 1820958 to 1820638)