Sequence retrieval

Genome: Chlamydia trachomatis strain J/27-97
Start position: 334257
End position: 334280
Length: 24

DNA sequence
>NC_022110, from 334257 to 334280 (24 bp); Chlamydia trachomatis strain J/27-97 TTTTTATTTCTTTATTTTTTTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 334277-337081	Sequence	O179_01615 - serine/threonine protein kinase (Protein is coded in complementary strand; from 337081 to 334277)