Sequence retrieval

Genome: Chlamydia trachomatis strain J/27-97
Start position: 651007
End position: 651042
Length: 36

DNA sequence
>NC_022110, from 651007 to 651042 (36 bp); Chlamydia trachomatis strain J/27-97 AAACAAGGGATTAAACAAGGGATCAAACAAGCCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 650006-651469	Sequence	O179_03175 - type III secretion system membrane protein