Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus 55/2053
Start position: 1279163
End position: 1279186
Length: 24

DNA sequence
>NC_022113, from 1279163 to 1279186 (24 bp); Staphylococcus aureus subsp. aureus 55/2053 CTGCTTCTTCTTCGGCTTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1279102-1279464	Sequence	SAAG_01958 - large-conductance mechanosensitive channel protein (Protein is coded in complementary strand; from 1279464 to 1279102)