Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus 55/2053
Start position: 2033587
End position: 2033610
Length: 24

DNA sequence
>NC_022113, from 2033587 to 2033610 (24 bp); Staphylococcus aureus subsp. aureus 55/2053 TCTGGATCTGGTTTTGGATCCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2032825-2034102	Sequence	SAAG_02532 - membrane anchored Ser-Asp rich fibrinogen-binding protein (Protein is coded in complementary strand; from 2034102 to 2032825)