Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus 55/2053
Start position: 1345398
End position: 1345422
Length: 25

DNA sequence
>NC_022113, from 1345398 to 1345422 (25 bp); Staphylococcus aureus subsp. aureus 55/2053 ATTTCAATTCATTTAGTTTCATGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1344848-1346191	Sequence	SAAG_02015 - branched-chain amino acid carrier protein (Protein is coded in complementary strand; from 1346191 to 1344848)