Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus 55/2053
Start position: 1032447
End position: 1032473
Length: 27

DNA sequence
>NC_022113, from 1032447 to 1032473 (27 bp); Staphylococcus aureus subsp. aureus 55/2053 GCTTTAACTTCTTTAACTGCTTTAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1030821-1032767	Sequence	SAAG_02237 - iron-regulated surface determinant protein B (Protein is coded in complementary strand; from 1032767 to 1030821)