Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus 55/2053
Start position: 2357922
End position: 2357948
Length: 27

DNA sequence
>NC_022113, from 2357922 to 2357948 (27 bp); Staphylococcus aureus subsp. aureus 55/2053 ACTTTATCACCTTTATCAAGTTTATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2357490-2358128	Sequence	SAAG_00179 - multidrug resistance efflux pump-protein (Protein is coded in complementary strand; from 2358128 to 2357490)