Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus 55/2053
Start position: 1492629
End position: 1492673
Length: 45

DNA sequence
>NC_022113, from 1492629 to 1492673 (45 bp); Staphylococcus aureus subsp. aureus 55/2053 TCCGTTTTCCGAAAACCCGTTTGCCGATAATCCGTTTTCCGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1492210-1492980	Sequence	SAAG_01378 - hypothetical protein (Protein is coded in complementary strand; from 1492980 to 1492210)