Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus 55/2053
Start position: 1487297
End position: 1487350
Length: 54

DNA sequence
>NC_022113, from 1487297 to 1487350 (54 bp); Staphylococcus aureus subsp. aureus 55/2053 AGTCCGAACTGTACGATGTGTCCGAACTGTACGATGTGTCCGAACTGTACGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1487296-1487766	Sequence	SAAG_01367 - hypothetical protein (Protein is coded in complementary strand; from 1487766 to 1487296)