Sequence retrieval

Genome: Staphylococcus aureus subsp. aureus 55/2053
Start position: 2655677
End position: 2655730
Length: 54

DNA sequence
>NC_022113, from 2655677 to 2655730 (54 bp); Staphylococcus aureus subsp. aureus 55/2053 TCTGAATCGCTGTCTGAATCTGAATCGCTATCTGAATCCGAATCGCTGTCTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2655182-2657965	Sequence	SAAG_02741 - clumping factor B (Protein is coded in complementary strand; from 2657965 to 2655182)