Sequence retrieval

Genome: Escherichia coli PMV-1
Start position: 1930358
End position: 1930381
Length: 24

DNA sequence
>NC_022370, from 1930358 to 1930381 (24 bp); Escherichia coli PMV-1 CGGGATCGGCATCGGCATCGGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1929633-1931189	Sequence	ECOPMV1_01908 yoaE_1 hypothetical protein (Protein is coded in complementary strand; from 1931189 to 1929633)