Sequence retrieval

Genome: Escherichia coli PMV-1
Start position: 3568894
End position: 3568920
Length: 27

DNA sequence
>NC_022370, from 3568894 to 3568920 (27 bp); Escherichia coli PMV-1 TGCACGACCAGCACGACCTGCACGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3568040-3569929	Sequence	ECOPMV1_03469 deaD Cold-shock DEAD box protein A (Protein is coded in complementary strand; from 3569929 to 3568040)