Sequence retrieval

Genome: Escherichia coli PMV-1
Start position: 3737973
End position: 3738002
Length: 30

DNA sequence
>NC_022370, from 3737973 to 3738002 (30 bp); Escherichia coli PMV-1 GTCGTGGTCGTGATCGTGGTGGTGATCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3737878-3738468	Sequence	ECOPMV1_03660 slyD FKBP-type peptidyl-prolyl cis-trans isomerase slyD (Protein is coded in complementary strand; from 3738468 to 3737878)