Sequence retrieval

Genome: Escherichia coli PMV-1
Start position: 4378107
End position: 4378130
Length: 24

DNA sequence
>NC_022370, from 4378107 to 4378130 (24 bp); Escherichia coli PMV-1 AATGCCAATGGCGATGCCAATTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4377400-4378326	Sequence	ECOPMV1_04267 rhaT L-rhamnose-H(+) transport protein (Protein is coded in complementary strand; from 4378326 to 4377400)