Sequence retrieval

Genome: Escherichia coli PMV-1
Start position: 543948
End position: 543971
Length: 24

DNA sequence
>NC_022370, from 543948 to 543971 (24 bp); Escherichia coli PMV-1 ATATCAATACCAATATCCATTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 543669-544904	Sequence	ECOPMV1_00504 allC Allantoate amidohydrolase (Protein is coded in complementary strand; from 544904 to 543669)