Sequence retrieval

Genome: Escherichia coli PMV-1
Start position: 77401
End position: 77424
Length: 24

DNA sequence
>NC_022370, from 77401 to 77424 (24 bp); Escherichia coli PMV-1 GCAGCAACAGCAGCAGCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 76701-78311	Sequence	ECOPMV1_00070 cysW_1 Sulfate transport system permease protein CysW (Protein is coded in complementary strand; from 78311 to 76701)