Sequence retrieval

Genome: Rhizobium sp. IRBG74
Start position: 1627564
End position: 1627587
Length: 24

DNA sequence
>NC_022535, from 1627564 to 1627587 (24 bp); Rhizobium sp. IRBG74 CAGATCCAGATCGAGATCGAGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1625828-1628872	Sequence	BN877_I1671 - Sporulation related protein (Protein is coded in complementary strand; from 1628872 to 1625828)