Sequence retrieval

Genome: Rhizobium sp. IRBG74
Start position: 1818374
End position: 1818397
Length: 24

DNA sequence
>NC_022535, from 1818374 to 1818397 (24 bp); Rhizobium sp. IRBG74 GATGGTGGTGGTGGTGGTGGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1818069-1818959	Sequence	BN877_I1901 - hypothetical protein (Protein is coded in complementary strand; from 1818959 to 1818069)