Sequence retrieval

Genome: Rhizobium sp. IRBG74
Start position: 2274333
End position: 2274362
Length: 30

DNA sequence
>NC_022535, from 2274333 to 2274362 (30 bp); Rhizobium sp. IRBG74 GGCGGCGGCCGGAGACGGCCGGCGGCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2274128-2275558	Sequence	BN877_I2384 der GTP-binding protein, essential for cell growth (Protein is coded in complementary strand; from 2275558 to 2274128)