Sequence retrieval

Genome: Rhizobium sp. IRBG74
Start position: 2331376
End position: 2331399
Length: 24

DNA sequence
>NC_022535, from 2331376 to 2331399 (24 bp); Rhizobium sp. IRBG74 CAGCACCAGAACCAGCCCCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2331056-2332432	Sequence	BN877_I2444 - Exopolysaccharide production protein exoQ (Protein is coded in complementary strand; from 2332432 to 2331056)