Sequence retrieval

Genome: Rhizobium sp. IRBG74
Start position: 3912
End position: 3935
Length: 24

DNA sequence
>NC_022535, from 3912 to 3935 (24 bp); Rhizobium sp. IRBG74 AGCCTGAACCTGAGCCTTTGCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3901-4383	Sequence	BN877_I0007 secB protein-export protein (Protein is coded in complementary strand; from 4383 to 3901)