Sequence retrieval

Genome: Rhizobium sp. IRBG74
Start position: 480959
End position: 480982
Length: 24

DNA sequence
>NC_022535, from 480959 to 480982 (24 bp); Rhizobium sp. IRBG74 TCCTCTTCCTCGTCTTCTTCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 480491-482137	Sequence	BN877_I0487 phaD multisubunit K+/H+ antiporter subunit D (Protein is coded in complementary strand; from 482137 to 480491)