Sequence retrieval

Genome: Rhizobium sp. IRBG74
Start position: 579957
End position: 579980
Length: 24

DNA sequence
>NC_022535, from 579957 to 579980 (24 bp); Rhizobium sp. IRBG74 AAATGCTGAAAAGCTGAAATCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 579470-580567	Sequence	BN877_I0584 potF1 putrescine/spermidine ABC transporter, substrate-binding component