Sequence retrieval

Genome: Rhizobium sp. IRBG74
Start position: 825982
End position: 826005
Length: 24

DNA sequence
>NC_022535, from 825982 to 826005 (24 bp); Rhizobium sp. IRBG74 CGTGATCATGATCGTGTTCGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 823869-826604	Sequence	BN877_I0826 - Copper/silver-translocating P-type ATPase,heavy metal-translocating P-type ATPase, Cd/Co/Hg/Pb/Zn-transporting (Protein is coded in complementary strand; from 826604 to 823869)