Sequence retrieval

Genome: Rhizobium sp. IRBG74
Start position: 911514
End position: 911537
Length: 24

DNA sequence
>NC_022535, from 911514 to 911537 (24 bp); Rhizobium sp. IRBG74 CGTCGATGTCGAGGTCGAGGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 911339-911593	Sequence	BN877_I0928 - hypothetical protein (Protein is coded in complementary strand; from 911593 to 911339)