Sequence retrieval

Genome: Listeria monocytogenes EGD
Start position: 2347771
End position: 2347794
Length: 24

DNA sequence
>NC_022568, from 2347771 to 2347794 (24 bp); Listeria monocytogenes EGD CAGAATCAAAATCATAATCAGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2347437-2347958	Sequence	LMON_2332 - ThiJ/PfpI family protein (Protein is coded in complementary strand; from 2347958 to 2347437)